Purchase Cell Line Products Here

CRISPR Knockout Cell Line Service


Glow Biologics offers one-stop-solution custom knockout cell line services using multi host cell lines ranging from tumor cell line to immortalized cell lines. 100% quality guaranteed.

Contact Us

USA
  • Tel: 1-917-242-6320
  • Fax: 1-917-242-6531
  • Email:
  • Address: 580 White Plains Rd, Tarrytown

Custom Gene Expression Cell Lines


Custom CRISPR Gene Knockout (KO) Cell Line Service

Glow Biologics has developed our unique CRISPR/Cas9 gene knockout platform to accurately knockout the designated genes. CRISPR allows for efficient and flexible gene knockout at competitive cost compared with traditional TALEN (transcription activator-like effector nuclease) and ZNF (zinc finger nuclease). Our scientists are experienced to provide single or double gene knockout using CRISPR/Cas9, from gRNA construction to transfection and single clone generation of a wide range of host cell lines, like HEK293T, HeLa, HCT116, HepG2, A549 and other difficult-to-transfect immortalized cell lines.

Service Content:

Content

Deliverables

Timeline

Price

Gene Knock out

 

(Single or Double genes)

· gRNA sequence (3-5 groups)

· Single cell clone

· QC & project report

~3-4 months

Inquiry

 

Highlights:

Ø 100% knockout monoclonal clones: We guarantee to provide the 100% KO single cell clones to our customers.

Ø Professional technical support: Our scientists have rich CRISPR genome editing and cell culture experiences.

Ø One-stop service is provided from gRNAs construction, cell transfection, single clones selection to sequencing analysis, our customers only need to provide the target genes and host cell line information.

Ø High success rate and low off-target rate: 3-5 groups of gRNAs are applied for design and verification; We also provide off-target analysis and detection.

Ø Fast delivery & full transparency: the knockout cell lines are delivered within 3 months.

Service Process:

 image.png

 

Process

  Project Evaluation

PhaseⅠ: gRNA Vector Construction

Phase Ⅱ: Cell Transfection and Monoclonal Clone Selection

Process

· Cell line’s amenability

· Target gene analysis

 

· gRNA design
(design 3 ~ 5 groups)

· gRNA vector construction

· gRNA target activity detection

· Vector Transfection

· Single Cell Clone screening

· Amplification culture

· Sequencing Validation

· Positive clone cryopreserved

Timeline

/

~2 weeks

~10-14 weeks

Deliverables

/

    gRNA sequence

· Single cell clone line

· Sequencing data

· Project report

 

Single Gene Knock Out Cell Line Generation Service Case:

Custom Human xx Knockout Cell Line in Swiss-3T3

Vector Map:

image.png 

 

sg1:aagcttaaacaaaggaagtc

image.png 

PCR Result:

image.png 

KO Sequencing Result:

image.png 

For quote, please fill in the online form and email to info@glowbiologics.com.


Quick Inquiry