Glow Biologics offers one-stop-solution custom knockout cell line services using multi host cell lines ranging from tumor cell line to immortalized cell lines. 100% quality guaranteed.
Custom CRISPR Gene Knockout (KO) Cell Line Service
Glow Biologics has developed our unique CRISPR/Cas9 gene knockout platform to accurately knockout the designated genes. CRISPR allows for efficient and flexible gene knockout at competitive cost compared with traditional TALEN (transcription activator-like effector nuclease) and ZNF (zinc finger nuclease). Our scientists are experienced to provide single or double gene knockout using CRISPR/Cas9, from gRNA construction to transfection and single clone generation of a wide range of host cell lines, like HEK293T, HeLa, HCT116, HepG2, A549 and other difficult-to-transfect immortalized cell lines.
Service Content:
Content | Deliverables | Timeline | Price |
Gene Knock out
(Single or Double genes) | · gRNA sequence (3-5 groups) · Single cell clone · QC & project report | ~3-4 months | Inquiry |
Highlights:
Ø 100% knockout monoclonal clones: We guarantee to provide the 100% KO single cell clones to our customers.
Ø Professional technical support: Our scientists have rich CRISPR genome editing and cell culture experiences.
Ø One-stop service is provided from gRNAs construction, cell transfection, single clones selection to sequencing analysis, our customers only need to provide the target genes and host cell line information.
Ø High success rate and low off-target rate: 3-5 groups of gRNAs are applied for design and verification; We also provide off-target analysis and detection.
Ø Fast delivery & full transparency: the knockout cell lines are delivered within 3 months.
Service Process:
Process | Project Evaluation | PhaseⅠ: gRNA Vector Construction | Phase Ⅱ: Cell Transfection and Monoclonal Clone Selection |
Process | · Cell line’s amenability · Target gene analysis
| · gRNA design · gRNA vector construction · gRNA target activity detection | · Vector Transfection · Single Cell Clone screening · Amplification culture · Sequencing Validation · Positive clone cryopreserved |
Timeline | / | ~2 weeks | ~10-14 weeks |
Deliverables | / | gRNA sequence | · Single cell clone line · Sequencing data · Project report |
Single Gene Knock Out Cell Line Generation Service Case:
Custom Human xx Knockout Cell Line in Swiss-3T3
Vector Map:
sg1：aagcttaaacaaaggaagtc
PCR Result:
KO Sequencing Result:
For quote, please fill in the online form and email to info@glowbiologics.com.